Eam from the putative 35 region (Fig. 6B; also see Fig. S8 inside the supplemental material). In allTTGATGTTTTATTATAATAACTATGTTAATTTTATATTTTCATAAAAATCCCTATCAGTGATAGAGAATTTTTGATATAATACCTTATTATCGCATA P40 tetO TTATTATTAGACGTAATTTTCTAATTCGGTTAATTTTTTCTTGCATTTTCCCTATCAGTGATAGAGAATATTGTTATACTTATATATACTAAACAAG tetO P79 AGGTGTACCAATTTTGTGTATTATATTTATTGTCTAATATTTTTAATTTCCCTATCAGTGATAGAGAAAACATGATAAAATAAATAAAAATAAAAAA tetO P94 TTGTATTAATGTTTAAATTATAATAATTTTGGCATTTTATATTAGATTTCCCTATCAGTGATAGAGAAAAACAATTATAATGTAGTAAACAATACCA P117 tetO GTTTCTGTAACATATTCTTGCTTATTCTGAAACTTATATTATAATAAGTCCCTATCAGTGATAGAGAACGAAACAAATAAAATAAAAAATAATTTAAGGA P135 tetO TTCGTGAATTTTTTAGTTTAATAGAATTTTTCTCTATCACTGATAGGGAGATAATGATACAATAATATAAAATTAAATTAATACATACTATCATAAC tetO P18 TTTTTGTATGATTATTATGAAATGTTCGTTTCTCTATCACTGATAGGGAAATTCTTCATAAATTTAATATTTATGCTATAATAAATGTGTTTTTAAG P39 tetO TTTTTTGTTATTGAGTTTACGTTAAGATTCAATTATATTATATAAAAGTCCCTATCAGTGATAGAGACTTGAATAGATATTTACAGTATAAAATTTT P19 tetO TTAGGCTTAATATTCTTGATTCTATACTATTATTTTATTATAATGTTTTCCCTATCAGTGATAGAGAAAAATAAACAAAAAGTCTATAAAAAACTGA tetO P20 TGGTATAATTTTAATATTTATCTTTTTATATCTCTATCACTGATAGGGAAACTGATAAAGAATGGCAAAAAGTATGTTATAATTAAAATAGCATTGC tetO PATTGTTTAATATCATTTGTAAGTTATTTTAATCTCTATCACTGATAGGGATAAATACCAATTGACATATATAAATGATTCTGATATAAATTAGATAAGGGA P146 tetOBFIG 6 Organization of synthetic DNA fragments that function as promoters in F. novicida. (A) TetR-regulated promoters. Robust to weak promoters are shownfrom top to bottom. The transcription get started, as determined by primer extension of mRNA, is indicated by large boldface letters. The ten and 35 regions are indicated by letters in boldface italic type. The tetO regions are indicated by an arrow. Underneath every promoter sequence is actually a diagrammatic representation from the promoter organization showing the partnership on the tetO region towards the 10/ 35 regions plus the transcriptional start out site. The TetR-regulated promoters P39 and P21 had five and two bp, respectively, between the 35 region and tetO. (B) Sequence and organization of the unregulated promoter P146.(6S)-Hexahydro-1,4-oxazepin-6-ol structure All the constitutive promoters that have been examined showed exactly the same organization (see Fig.5-Bromobenzene-1,3-diamine structure S8 in the supplemental material).PMID:23695992 Within the diagrams, the squares represent the 10/ 35 regions, the circle represents the transcriptional get started web site, and the arrow represents the tetO area. The DNA sequences of 185 synthetic F. novicida promoters are supplied in Data Set 1 within the supplemental material.January 2014 Volume 80 Numberaem.asm.orgMcWhinnie and Nano4000 3000 LacZ activity 2000 1000 50 50 40 30 20 10PE PE 80 1 PE 1 four 12 PE six 9 PE eight 7 PE four 69 PE PE 87 13 PE 2 9 PE 1 75 P4 0 P2 P1 0 46 Pb frFull length promoter Upstream deletionUninduced ATc inducedLacZ activityP1P1P1FIG 7 -Galactosidase expression in E. coli driven by synthetic promoters.Promoters using a “PE” prefix had been selected in E. coli, and their functionality in driving the expression of -galactosidase in E. coli MGZ1 expressing TetR is shown. The activities on the synthetic, inducible (P20 and P40); constitutive (P146); and natural (Pbfr) promoters chosen or isolated in F. novicida or F. tularensis are also shown. Values around the y axis are arbitrary luminosity units. Error bars represent common errors in the indicates.FIG eight -Galactosidase expression driven by minimal promoters in F. novicida. Open bars represent activity in strains getting the original promoters that contained tetO. Filled bars represent activity expressed from strains carrying promoters from which the nucleotides fol.
